nonparametric (mann-whitney) test graphpad prism 8.0 software Search Results


verikine mouse ifn b elisa kit pbl assay science  (PBL Assay)
95
PBL Assay verikine mouse ifn b elisa kit pbl assay science
Figure 2. ANKIB1 deficiency enhances antiviral immune responses (A) Lung tissues from ANKIB1+/+ or ANKIB1/ mice (n = 9) were infected with SeV for 24 h, and the expression levels of IFN-b, TNF-a, and IL-6 in the lung homogenates were analyzed by <t>ELISA.</t> (B and C) Lung tissues from ANKIB1+/+ or ANKIB1/ mice (n = 9) were infected with SeV for 12 h, and the mRNA levels of Ifnb1, Tnfa, or Il6 (B), and downstream ISG Ifit1, Ifit2, or Isg15 (C) were then analyzed by qPCR. (D and E) Lung tissues from ANKIB1+/+ or ANKIB1/ mice (n = 9) were infected with SeV for 12 h, and the mRNA levels of SeV mock-infected (M) or NP mRNA (D) were then analyzed by qPCR. The SeV titers (E) were quantified by plaque assay on MDCK cells. (F) ANKIB1+/+ or ANKIB1/ mice (n = 15) were mock infected or infected with SeV (2,000 plaque-forming units [PFUs]/mouse) for 14 days. The survival rates of the infected mice were determined. The log-rank (Mantel-Cox) test was used to analyze the survival curve. (G) ANKIB1+/+ or ANKIB1/ mice (n = 15) were mock infected or infected with SeV for 2 or 7 days. The lung indices (1003 lung/body weight) were measured. (H) Lung tissues from ANKIB1+/+ or ANKIB1/ mice mock infected or infected with SeV for 7 days were fixed and stained with H&E. Scale bars, 100 mm. Results are represented as the mean ± SD from at least three separate assays. p values were calculated using the Mann-Whitney test. **p < 0.01, ***p < 0.001, and ****p < 0.0001; ns indicates no significant difference.
Verikine Mouse Ifn B Elisa Kit Pbl Assay Science, supplied by PBL Assay, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nonparametric+(mann-whitney)+test+graphpad+prism+8%2E0+software/VeriKine+Mouse+IFN-Beta+ELISA+Kit/pm39213157-175-44-49
Average 95 stars, based on 1 article reviews
verikine mouse ifn b elisa kit pbl assay science - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier
2017 n a agxt human tagged orf  (OriGene)
90
OriGene 2017 n a agxt human tagged orf
Figure 1. Dysregulated glycine and oxalate metabolism in patients and mice with atherosclerosis (A) Schematic representation of glycine metabolic pathways. (B–E) Targeted metabolomics assessing the ratios of glycine to (B) serine, (C) threonine, (D) alanine, and (E) oxalate in serum from age- and sex- matched patients with or without sCAD (n = 24). (F) En face analysis of atherosclerotic lesions in male Apoe/ mice fed a standard diet (SD) or Western diet (WD) for 12 weeks (n = 5). (G–J) Targeted metabolomics assessing the ratios of glycine to (G) serine, (H) threonine, (I) alanine, and (J) oxalate in plasma from male Apoe/ mice fed a SD or WD for 12 weeks (n = 5). (K) Western blot analysis of <t>AGXT</t> protein abun- dance in livers from Apoe/ mice fed a SD or WD for 12 weeks (n = 5). Mann-Whitney U test for (B)-(E), (G), (H), and (K). Unpaired t test for (F), (I), and (J). Data are pre- sented as mean ± SEM. All points and p values are shown.
2017 N A Agxt Human Tagged Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nonparametric+(mann-whitney)+test+graphpad+prism+8%2E0+software/AGXT+(NM_000030)+Human+Tagged+ORF+Clone+Lentiviral+Particle/pm34320345-277-135-142
Average 90 stars, based on 1 article reviews
2017 n a agxt human tagged orf - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
n a n a recombinant dna pdcd1 cdna coding vector origene sc117011 pdcd1 cdna coding vector  (OriGene)
91
OriGene n a n a recombinant dna pdcd1 cdna coding vector origene sc117011 pdcd1 cdna coding vector
Figure 1. MTDs Impair Cell Surface Expression <t>of</t> <t>PD-1</t> by T Lymphocytes (A) Drug screen for inhibitors of cell surface PD-1 expression by human T cells gated from activated PBMCs. Microtubule-unrelated drugs (gray) and significant hits after Bonferroni correction for multiple comparisons versus untreated stimulated cells are shown as colored bars. CPT, camptothecin. n = 6, means ± SDs. (B) Representative contour plots of PD-1 and CD69 expression by resting and stimulated T lymphocytes treated or not treated with CI-980 (10 nM); gated from PBMC; representative of 6 experiments; percentages of cells in gate are shown. (C) Cell surface PD-1 expression by activated CD4+, CD8+, and TCR gd T lymphocytes (gated from activated PBMCs), treated or not treated with CI-980 (10 nM); representative of 6 experiments; percentages of cells in gate are shown. (D) CD3 and CD4, CD8, and TCR Vg9 expression by activated CD3+CD4+, CD3+CD8+, and CD3+TCR Vg9+ T cells, respectively, treated or not treated with CI-980 (10 nM); representative of 6 experiments. (E) CD3+ T cell differentiation, defined by the CD45RA and CCR7 markers, in treated (CI-980, 10 nM) or untreated conditions; representative of 6 experiments. (F–H) Quantification of the effect of CI-980 (10 nM) on CD3+ T cell differentiation (F), and on CD69 (G) and PD-1 (H) expression by the naive (CD45RA+CCR7+), central memory (CM) (CD45RACCR7+), effector memory (EM) (CD45RACCR7), and terminally differentiated effector memory (EMRA) (CD45RA+CCR7) T cells (n = 6, means ± SDs). Wilcoxon test; *p < 0.05, ***p < 0.001, ****p < 0.0001. (I) PD-1 inhibition level on activated T lymphocytes (gated from activated PBMCs) treated with MTDs including colchicin-binding site drugs (range of reds), vinca alkaloids (range of oranges), and taxane (green). CBT-A4, combretastatin-A4; PPTx, podophyllotoxin; b-Lumi, b-lumicolchicine (n = 6, means ± SDs).
N A N A Recombinant Dna Pdcd1 Cdna Coding Vector Origene Sc117011 Pdcd1 Cdna Coding Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nonparametric+(mann-whitney)+test+graphpad+prism+8%2E0+software/PD1+(PDCD1)+(NM_005018)+Human+Untagged+Clone/pm30605689-200-102-110
Average 91 stars, based on 1 article reviews
n a n a recombinant dna pdcd1 cdna coding vector origene sc117011 pdcd1 cdna coding vector - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

Image Search Results


Figure 2. ANKIB1 deficiency enhances antiviral immune responses (A) Lung tissues from ANKIB1+/+ or ANKIB1/ mice (n = 9) were infected with SeV for 24 h, and the expression levels of IFN-b, TNF-a, and IL-6 in the lung homogenates were analyzed by ELISA. (B and C) Lung tissues from ANKIB1+/+ or ANKIB1/ mice (n = 9) were infected with SeV for 12 h, and the mRNA levels of Ifnb1, Tnfa, or Il6 (B), and downstream ISG Ifit1, Ifit2, or Isg15 (C) were then analyzed by qPCR. (D and E) Lung tissues from ANKIB1+/+ or ANKIB1/ mice (n = 9) were infected with SeV for 12 h, and the mRNA levels of SeV mock-infected (M) or NP mRNA (D) were then analyzed by qPCR. The SeV titers (E) were quantified by plaque assay on MDCK cells. (F) ANKIB1+/+ or ANKIB1/ mice (n = 15) were mock infected or infected with SeV (2,000 plaque-forming units [PFUs]/mouse) for 14 days. The survival rates of the infected mice were determined. The log-rank (Mantel-Cox) test was used to analyze the survival curve. (G) ANKIB1+/+ or ANKIB1/ mice (n = 15) were mock infected or infected with SeV for 2 or 7 days. The lung indices (1003 lung/body weight) were measured. (H) Lung tissues from ANKIB1+/+ or ANKIB1/ mice mock infected or infected with SeV for 7 days were fixed and stained with H&E. Scale bars, 100 mm. Results are represented as the mean ± SD from at least three separate assays. p values were calculated using the Mann-Whitney test. **p < 0.01, ***p < 0.001, and ****p < 0.0001; ns indicates no significant difference.

Journal: Cell reports

Article Title: E3 ubiquitin ligase ANKIB1 attenuates antiviral immune responses by promoting K48-linked polyubiquitination of MAVS.

doi: 10.1016/j.celrep.2024.114687

Figure Lengend Snippet: Figure 2. ANKIB1 deficiency enhances antiviral immune responses (A) Lung tissues from ANKIB1+/+ or ANKIB1/ mice (n = 9) were infected with SeV for 24 h, and the expression levels of IFN-b, TNF-a, and IL-6 in the lung homogenates were analyzed by ELISA. (B and C) Lung tissues from ANKIB1+/+ or ANKIB1/ mice (n = 9) were infected with SeV for 12 h, and the mRNA levels of Ifnb1, Tnfa, or Il6 (B), and downstream ISG Ifit1, Ifit2, or Isg15 (C) were then analyzed by qPCR. (D and E) Lung tissues from ANKIB1+/+ or ANKIB1/ mice (n = 9) were infected with SeV for 12 h, and the mRNA levels of SeV mock-infected (M) or NP mRNA (D) were then analyzed by qPCR. The SeV titers (E) were quantified by plaque assay on MDCK cells. (F) ANKIB1+/+ or ANKIB1/ mice (n = 15) were mock infected or infected with SeV (2,000 plaque-forming units [PFUs]/mouse) for 14 days. The survival rates of the infected mice were determined. The log-rank (Mantel-Cox) test was used to analyze the survival curve. (G) ANKIB1+/+ or ANKIB1/ mice (n = 15) were mock infected or infected with SeV for 2 or 7 days. The lung indices (1003 lung/body weight) were measured. (H) Lung tissues from ANKIB1+/+ or ANKIB1/ mice mock infected or infected with SeV for 7 days were fixed and stained with H&E. Scale bars, 100 mm. Results are represented as the mean ± SD from at least three separate assays. p values were calculated using the Mann-Whitney test. **p < 0.01, ***p < 0.001, and ****p < 0.0001; ns indicates no significant difference.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Protein G Sepharose Santa Cruz Cat# sc-2003 Protease Inhibitor Cocktail Roche Cat# 11873580001 PVDF membranes Millipore Cat# ISEQ00010 Penicillin-Streptomycin Solution Hyclone Cat# SV30010 Critical commercial assays cDNA Synthesis Kit Vazyme Cat# R323-01 BCA Protein Assay Kit Thermo Cat# 23225 VeriKine mouse IFN-b ELISA kit PBL Assay Science Cat# 42400-2 TNF-a Mouse ELISA Kit Invitrogen Cat# BMS607-3 IL-6 Mouse ELISA Kit Invitrogen Cat# KMC0061 Luciferase reporter assay kit Promega Cat #E1980 TB Green Premix Ex TaqTM II Takara Cat# R820A Experimental models: Cell lines HEK293T cells ATCC Cat# CRL-3216; RRID: CVCL_0063 HeLa cells ATCC Cat# CCL-2; RRID: CVCL_0030 MDCK cells ATCC Cat# CCL-34 ANKIB1 / HK293T cells This paper N/A ANKIB1 / HeLa cells This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 This paper N/A Mouse: ANKIB1 / C57BL/6 Cyagen Biosciences Cat# S-KO-13429 Oligonucleotides sgRNA targeting human ANKIB1 sequence: GATGAGTGCTTTACGGAATT AATTCCGTAAAGCACTCATC This paper N/A sgRNA targeting mouse ANKIB1 sequence: GCATGGTGTTGCTACCCTCCAGG CTCTGCGTCCCCTGTTCCACTGG This paper N/A Primers for Quantitative PCR (qPCR), see Table S1 This paper N/A siRNA for gene knockdown, see Table S2 This paper N/A Primers for mouse genotyping, see Table S3 This paper N/A Recombinant DNA Gene mutants and truncations, see plasmids part in method details This paper N/A Software and algorithms ImageJ ImageJ https://imagej.net/Welcome Graphpad 8.0 Graphpad 8.0 https://www.graphpad.com/ scientificsoftware/prism/ BioRender BioRender https://app.biorender.com/

Techniques: Infection, Expressing, Enzyme-linked Immunosorbent Assay, Plaque Assay, Staining, MANN-WHITNEY

Figure 1. Dysregulated glycine and oxalate metabolism in patients and mice with atherosclerosis (A) Schematic representation of glycine metabolic pathways. (B–E) Targeted metabolomics assessing the ratios of glycine to (B) serine, (C) threonine, (D) alanine, and (E) oxalate in serum from age- and sex- matched patients with or without sCAD (n = 24). (F) En face analysis of atherosclerotic lesions in male Apoe/ mice fed a standard diet (SD) or Western diet (WD) for 12 weeks (n = 5). (G–J) Targeted metabolomics assessing the ratios of glycine to (G) serine, (H) threonine, (I) alanine, and (J) oxalate in plasma from male Apoe/ mice fed a SD or WD for 12 weeks (n = 5). (K) Western blot analysis of AGXT protein abun- dance in livers from Apoe/ mice fed a SD or WD for 12 weeks (n = 5). Mann-Whitney U test for (B)-(E), (G), (H), and (K). Unpaired t test for (F), (I), and (J). Data are pre- sented as mean ± SEM. All points and p values are shown.

Journal: Cell reports

Article Title: Dysregulated oxalate metabolism is a driver and therapeutic target in atherosclerosis.

doi: 10.1016/j.celrep.2021.109420

Figure Lengend Snippet: Figure 1. Dysregulated glycine and oxalate metabolism in patients and mice with atherosclerosis (A) Schematic representation of glycine metabolic pathways. (B–E) Targeted metabolomics assessing the ratios of glycine to (B) serine, (C) threonine, (D) alanine, and (E) oxalate in serum from age- and sex- matched patients with or without sCAD (n = 24). (F) En face analysis of atherosclerotic lesions in male Apoe/ mice fed a standard diet (SD) or Western diet (WD) for 12 weeks (n = 5). (G–J) Targeted metabolomics assessing the ratios of glycine to (G) serine, (H) threonine, (I) alanine, and (J) oxalate in plasma from male Apoe/ mice fed a SD or WD for 12 weeks (n = 5). (K) Western blot analysis of AGXT protein abun- dance in livers from Apoe/ mice fed a SD or WD for 12 weeks (n = 5). Mann-Whitney U test for (B)-(E), (G), (H), and (K). Unpaired t test for (F), (I), and (J). Data are pre- sented as mean ± SEM. All points and p values are shown.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer sequences for Agxt genotyping:, forward: 50-ACACCTCCACTGTCCTG TCC-30 Integrated DNA Technologies N/A Primer sequences for Agxt genotyping:, reverse: 50-GGTCAGATCTGCCTGCTA CC-30 Integrated DNA Technologies N/A Primer for Sanger sequencing:, 50-GCAGAGCTAGCTGGGAAATG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, forward: 50-GCCTAGCCGAGGGAGAG CCG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 1: 50-TGTGACTTGGGAGCTC TGCAGC-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 2: 50-GCCGCCCCGACTGC ATCT-30 Integrated DNA Technologies N/A Primer sequences for qPCR, see Table S2 Integrated DNA Technologies N/A Recombinant DNA pAdDeltaF6 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV2/8 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-GFP Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-MCS Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A AGXT Human Tagged ORF Clone Origene CAT# RG212899 Software and algorithms ImageJ National Institutes of Health RRID:SCR_003070 https://imagej.nih.gov/ ij/download.html GraphPad Prism GraphPad Software Version 8.0 RRID:SCR_002798 https:// www.graphpad.com/scientific-software/ prism/ R statistics Hosted by Vienna, University of Economics and Business http://www.R-project.org/ RStudio RStudio Team (2020). https://www.rstudio.com/ RRID:SCR_000432 IBM SPSS software IBM Corporation Version 23.0; RRID:SCR_019096 https:// www.ibm.com/analytics/ spss-statistics-software FastQC Babraham Bioinformatics Version 0.11.8 RRID:SCR_014583 https:// www.bioinformatics.babraham.ac.uk/ projects/fastqc/ Trimmomatic Bolger et al., 2014 Version 0.35 RRID:SCR_011848 http:// www.usadellab.org/cms/? page=trimmomatic HISAT2 Kim et al., 2015 Version 2.1.0.13; RRID:SCR_015530 http:// daehwankimlab.github.io/hisat2/ download/ HTSeq Anders et al., 2015 Version 0.6.0; RRID:SCR_005514 https:// htseq.readthedocs.io/en/master/install. html (Continued on next page) Cell Reports 36, 109420, July 27, 2021 e3 Article ll OPEN ACCESS

Techniques: Western Blot, Clinical Proteomics, MANN-WHITNEY

Figure 2. AGXT deficiency exacerbates atherosclerosis in male Apoe/ mice (A) Western blot analysis confirming the loss of AGXT in livers from male Agxt//Apoe/ mice (n = 6). (B) Glycine/oxalate ratio in plasma from male Agxt//Apoe/ mice and their Agxt+/+/Apoe/

Journal: Cell reports

Article Title: Dysregulated oxalate metabolism is a driver and therapeutic target in atherosclerosis.

doi: 10.1016/j.celrep.2021.109420

Figure Lengend Snippet: Figure 2. AGXT deficiency exacerbates atherosclerosis in male Apoe/ mice (A) Western blot analysis confirming the loss of AGXT in livers from male Agxt//Apoe/ mice (n = 6). (B) Glycine/oxalate ratio in plasma from male Agxt//Apoe/ mice and their Agxt+/+/Apoe/

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer sequences for Agxt genotyping:, forward: 50-ACACCTCCACTGTCCTG TCC-30 Integrated DNA Technologies N/A Primer sequences for Agxt genotyping:, reverse: 50-GGTCAGATCTGCCTGCTA CC-30 Integrated DNA Technologies N/A Primer for Sanger sequencing:, 50-GCAGAGCTAGCTGGGAAATG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, forward: 50-GCCTAGCCGAGGGAGAG CCG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 1: 50-TGTGACTTGGGAGCTC TGCAGC-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 2: 50-GCCGCCCCGACTGC ATCT-30 Integrated DNA Technologies N/A Primer sequences for qPCR, see Table S2 Integrated DNA Technologies N/A Recombinant DNA pAdDeltaF6 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV2/8 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-GFP Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-MCS Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A AGXT Human Tagged ORF Clone Origene CAT# RG212899 Software and algorithms ImageJ National Institutes of Health RRID:SCR_003070 https://imagej.nih.gov/ ij/download.html GraphPad Prism GraphPad Software Version 8.0 RRID:SCR_002798 https:// www.graphpad.com/scientific-software/ prism/ R statistics Hosted by Vienna, University of Economics and Business http://www.R-project.org/ RStudio RStudio Team (2020). https://www.rstudio.com/ RRID:SCR_000432 IBM SPSS software IBM Corporation Version 23.0; RRID:SCR_019096 https:// www.ibm.com/analytics/ spss-statistics-software FastQC Babraham Bioinformatics Version 0.11.8 RRID:SCR_014583 https:// www.bioinformatics.babraham.ac.uk/ projects/fastqc/ Trimmomatic Bolger et al., 2014 Version 0.35 RRID:SCR_011848 http:// www.usadellab.org/cms/? page=trimmomatic HISAT2 Kim et al., 2015 Version 2.1.0.13; RRID:SCR_015530 http:// daehwankimlab.github.io/hisat2/ download/ HTSeq Anders et al., 2015 Version 0.6.0; RRID:SCR_005514 https:// htseq.readthedocs.io/en/master/install. html (Continued on next page) Cell Reports 36, 109420, July 27, 2021 e3 Article ll OPEN ACCESS

Techniques: Western Blot, Clinical Proteomics

Figure 3. Oxalate homeostasis is main- tained and atherosclerosis is unaltered in fe- male Agxt//Apoe/ mice (A) Western blot analysis confirming the loss of AGXT in livers from female Agxt//Apoe/ mice (n = 6). (B) GlGlycine/oxalate ratio in plasma from female Agxt//Apoe/ and Agxt+/+/Apoe/ mice (n = 10). (C–G) Female Agxt//Apoe/ and Agxt+/+/ Apoe/ mice were fed a WD for 12 weeks (n = 10): (C) plasma TC, (D) atherosclerosis in the aortic tree, (E) H&E staining, (F) ORO staining, and (G) Mac-2 immunohistochemistry of aortic sinus. Scale bars, 200 mm. Unpaired t test for (B), (D), (E), and (G). Mann- Whitney U test for (C) and (F). Data are presented as mean ± SEM. All points and p values are shown.

Journal: Cell reports

Article Title: Dysregulated oxalate metabolism is a driver and therapeutic target in atherosclerosis.

doi: 10.1016/j.celrep.2021.109420

Figure Lengend Snippet: Figure 3. Oxalate homeostasis is main- tained and atherosclerosis is unaltered in fe- male Agxt//Apoe/ mice (A) Western blot analysis confirming the loss of AGXT in livers from female Agxt//Apoe/ mice (n = 6). (B) GlGlycine/oxalate ratio in plasma from female Agxt//Apoe/ and Agxt+/+/Apoe/ mice (n = 10). (C–G) Female Agxt//Apoe/ and Agxt+/+/ Apoe/ mice were fed a WD for 12 weeks (n = 10): (C) plasma TC, (D) atherosclerosis in the aortic tree, (E) H&E staining, (F) ORO staining, and (G) Mac-2 immunohistochemistry of aortic sinus. Scale bars, 200 mm. Unpaired t test for (B), (D), (E), and (G). Mann- Whitney U test for (C) and (F). Data are presented as mean ± SEM. All points and p values are shown.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer sequences for Agxt genotyping:, forward: 50-ACACCTCCACTGTCCTG TCC-30 Integrated DNA Technologies N/A Primer sequences for Agxt genotyping:, reverse: 50-GGTCAGATCTGCCTGCTA CC-30 Integrated DNA Technologies N/A Primer for Sanger sequencing:, 50-GCAGAGCTAGCTGGGAAATG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, forward: 50-GCCTAGCCGAGGGAGAG CCG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 1: 50-TGTGACTTGGGAGCTC TGCAGC-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 2: 50-GCCGCCCCGACTGC ATCT-30 Integrated DNA Technologies N/A Primer sequences for qPCR, see Table S2 Integrated DNA Technologies N/A Recombinant DNA pAdDeltaF6 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV2/8 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-GFP Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-MCS Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A AGXT Human Tagged ORF Clone Origene CAT# RG212899 Software and algorithms ImageJ National Institutes of Health RRID:SCR_003070 https://imagej.nih.gov/ ij/download.html GraphPad Prism GraphPad Software Version 8.0 RRID:SCR_002798 https:// www.graphpad.com/scientific-software/ prism/ R statistics Hosted by Vienna, University of Economics and Business http://www.R-project.org/ RStudio RStudio Team (2020). https://www.rstudio.com/ RRID:SCR_000432 IBM SPSS software IBM Corporation Version 23.0; RRID:SCR_019096 https:// www.ibm.com/analytics/ spss-statistics-software FastQC Babraham Bioinformatics Version 0.11.8 RRID:SCR_014583 https:// www.bioinformatics.babraham.ac.uk/ projects/fastqc/ Trimmomatic Bolger et al., 2014 Version 0.35 RRID:SCR_011848 http:// www.usadellab.org/cms/? page=trimmomatic HISAT2 Kim et al., 2015 Version 2.1.0.13; RRID:SCR_015530 http:// daehwankimlab.github.io/hisat2/ download/ HTSeq Anders et al., 2015 Version 0.6.0; RRID:SCR_005514 https:// htseq.readthedocs.io/en/master/install. html (Continued on next page) Cell Reports 36, 109420, July 27, 2021 e3 Article ll OPEN ACCESS

Techniques: Western Blot, Clinical Proteomics, Staining, Immunohistochemistry, MANN-WHITNEY

Figure 4. Dysregulated oxalate metabolism induces a pro-inflammatory response and CCL5 release (A–C) RNA sequencing of livers collected from male Agxt//Apoe/ and Agxt+/+/Apoe/ mice fed a WD for 12 weeks (n = 5): (A) volcano plot of DEGs (padj < 0.05, log2 fold change > 1) in male Agxt//Apoe/ versus Agxt+/+/Apoe/ mice (blue indicates downregulated; red indicates upregulated). (B) Kyoto Encyclopedia of Genes and Genomes (KEGG)-based pathway analysis. The significance of the enrichment was determined by a right-tailed Fisher’s exact test followed by a Benjamini-Hochberg multiple testing adjustment. (C) Heatmap-based representation of 50 DEGs linking inflammation, fibrogenesis, and the metabolism of lipids and sterols/steroids with atherosclerosis.

Journal: Cell reports

Article Title: Dysregulated oxalate metabolism is a driver and therapeutic target in atherosclerosis.

doi: 10.1016/j.celrep.2021.109420

Figure Lengend Snippet: Figure 4. Dysregulated oxalate metabolism induces a pro-inflammatory response and CCL5 release (A–C) RNA sequencing of livers collected from male Agxt//Apoe/ and Agxt+/+/Apoe/ mice fed a WD for 12 weeks (n = 5): (A) volcano plot of DEGs (padj < 0.05, log2 fold change > 1) in male Agxt//Apoe/ versus Agxt+/+/Apoe/ mice (blue indicates downregulated; red indicates upregulated). (B) Kyoto Encyclopedia of Genes and Genomes (KEGG)-based pathway analysis. The significance of the enrichment was determined by a right-tailed Fisher’s exact test followed by a Benjamini-Hochberg multiple testing adjustment. (C) Heatmap-based representation of 50 DEGs linking inflammation, fibrogenesis, and the metabolism of lipids and sterols/steroids with atherosclerosis.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer sequences for Agxt genotyping:, forward: 50-ACACCTCCACTGTCCTG TCC-30 Integrated DNA Technologies N/A Primer sequences for Agxt genotyping:, reverse: 50-GGTCAGATCTGCCTGCTA CC-30 Integrated DNA Technologies N/A Primer for Sanger sequencing:, 50-GCAGAGCTAGCTGGGAAATG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, forward: 50-GCCTAGCCGAGGGAGAG CCG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 1: 50-TGTGACTTGGGAGCTC TGCAGC-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 2: 50-GCCGCCCCGACTGC ATCT-30 Integrated DNA Technologies N/A Primer sequences for qPCR, see Table S2 Integrated DNA Technologies N/A Recombinant DNA pAdDeltaF6 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV2/8 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-GFP Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-MCS Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A AGXT Human Tagged ORF Clone Origene CAT# RG212899 Software and algorithms ImageJ National Institutes of Health RRID:SCR_003070 https://imagej.nih.gov/ ij/download.html GraphPad Prism GraphPad Software Version 8.0 RRID:SCR_002798 https:// www.graphpad.com/scientific-software/ prism/ R statistics Hosted by Vienna, University of Economics and Business http://www.R-project.org/ RStudio RStudio Team (2020). https://www.rstudio.com/ RRID:SCR_000432 IBM SPSS software IBM Corporation Version 23.0; RRID:SCR_019096 https:// www.ibm.com/analytics/ spss-statistics-software FastQC Babraham Bioinformatics Version 0.11.8 RRID:SCR_014583 https:// www.bioinformatics.babraham.ac.uk/ projects/fastqc/ Trimmomatic Bolger et al., 2014 Version 0.35 RRID:SCR_011848 http:// www.usadellab.org/cms/? page=trimmomatic HISAT2 Kim et al., 2015 Version 2.1.0.13; RRID:SCR_015530 http:// daehwankimlab.github.io/hisat2/ download/ HTSeq Anders et al., 2015 Version 0.6.0; RRID:SCR_005514 https:// htseq.readthedocs.io/en/master/install. html (Continued on next page) Cell Reports 36, 109420, July 27, 2021 e3 Article ll OPEN ACCESS

Techniques: RNA Sequencing

Figure 5. Oxalate overload induces mito- chondrial dysfunction and overproduction of superoxide, leading to CCL5 release in macrophages (A) qPCR analyses of genes regulating redox ho- meostasis in livers from male Agxt//Apoe/

Journal: Cell reports

Article Title: Dysregulated oxalate metabolism is a driver and therapeutic target in atherosclerosis.

doi: 10.1016/j.celrep.2021.109420

Figure Lengend Snippet: Figure 5. Oxalate overload induces mito- chondrial dysfunction and overproduction of superoxide, leading to CCL5 release in macrophages (A) qPCR analyses of genes regulating redox ho- meostasis in livers from male Agxt//Apoe/

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer sequences for Agxt genotyping:, forward: 50-ACACCTCCACTGTCCTG TCC-30 Integrated DNA Technologies N/A Primer sequences for Agxt genotyping:, reverse: 50-GGTCAGATCTGCCTGCTA CC-30 Integrated DNA Technologies N/A Primer for Sanger sequencing:, 50-GCAGAGCTAGCTGGGAAATG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, forward: 50-GCCTAGCCGAGGGAGAG CCG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 1: 50-TGTGACTTGGGAGCTC TGCAGC-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 2: 50-GCCGCCCCGACTGC ATCT-30 Integrated DNA Technologies N/A Primer sequences for qPCR, see Table S2 Integrated DNA Technologies N/A Recombinant DNA pAdDeltaF6 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV2/8 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-GFP Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-MCS Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A AGXT Human Tagged ORF Clone Origene CAT# RG212899 Software and algorithms ImageJ National Institutes of Health RRID:SCR_003070 https://imagej.nih.gov/ ij/download.html GraphPad Prism GraphPad Software Version 8.0 RRID:SCR_002798 https:// www.graphpad.com/scientific-software/ prism/ R statistics Hosted by Vienna, University of Economics and Business http://www.R-project.org/ RStudio RStudio Team (2020). https://www.rstudio.com/ RRID:SCR_000432 IBM SPSS software IBM Corporation Version 23.0; RRID:SCR_019096 https:// www.ibm.com/analytics/ spss-statistics-software FastQC Babraham Bioinformatics Version 0.11.8 RRID:SCR_014583 https:// www.bioinformatics.babraham.ac.uk/ projects/fastqc/ Trimmomatic Bolger et al., 2014 Version 0.35 RRID:SCR_011848 http:// www.usadellab.org/cms/? page=trimmomatic HISAT2 Kim et al., 2015 Version 2.1.0.13; RRID:SCR_015530 http:// daehwankimlab.github.io/hisat2/ download/ HTSeq Anders et al., 2015 Version 0.6.0; RRID:SCR_005514 https:// htseq.readthedocs.io/en/master/install. html (Continued on next page) Cell Reports 36, 109420, July 27, 2021 e3 Article ll OPEN ACCESS

Techniques:

Figure 6. AAV-mediated overexpression of AGXT reduces oxidative stress and inflammation AAV-AGXT or AAV-GFP was injected into male Apoe/ mice and the mice were fed a WD for 12 weeks (n = 8). (A) Western blot analysis confirming the over- expression of AGXT in livers from mice treated with AAV-AGXT. (B) Plasma glycine/oxalate ratio. (C and D) qPCR analyses of genes regulating (C) redox homeostasis and (D) inflammatory re- sponses. Gene expression levels were normalized to 18S. (E and F) Plasma concentrations of (E) CCL2 and (F) CCL5. (G) DHE fluorescence and Mac-2 immunofluores- cence in the aortic sinuses. Scale bars, 50 mm. Unpaired t test for (B), (E), and (G), and Mann- Whitney U test for (F). Statistical differences in gene expression in (C) and (D) were tested using unpaired t test or Mann-Whitney U test, depending on normality tests. *P < 0.05, **P <0.01, ***P <0.001 versus mice injected with AAV-GFP. Data are presented as mean ± SEM. All points and p values are shown.

Journal: Cell reports

Article Title: Dysregulated oxalate metabolism is a driver and therapeutic target in atherosclerosis.

doi: 10.1016/j.celrep.2021.109420

Figure Lengend Snippet: Figure 6. AAV-mediated overexpression of AGXT reduces oxidative stress and inflammation AAV-AGXT or AAV-GFP was injected into male Apoe/ mice and the mice were fed a WD for 12 weeks (n = 8). (A) Western blot analysis confirming the over- expression of AGXT in livers from mice treated with AAV-AGXT. (B) Plasma glycine/oxalate ratio. (C and D) qPCR analyses of genes regulating (C) redox homeostasis and (D) inflammatory re- sponses. Gene expression levels were normalized to 18S. (E and F) Plasma concentrations of (E) CCL2 and (F) CCL5. (G) DHE fluorescence and Mac-2 immunofluores- cence in the aortic sinuses. Scale bars, 50 mm. Unpaired t test for (B), (E), and (G), and Mann- Whitney U test for (F). Statistical differences in gene expression in (C) and (D) were tested using unpaired t test or Mann-Whitney U test, depending on normality tests. *P < 0.05, **P <0.01, ***P <0.001 versus mice injected with AAV-GFP. Data are presented as mean ± SEM. All points and p values are shown.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer sequences for Agxt genotyping:, forward: 50-ACACCTCCACTGTCCTG TCC-30 Integrated DNA Technologies N/A Primer sequences for Agxt genotyping:, reverse: 50-GGTCAGATCTGCCTGCTA CC-30 Integrated DNA Technologies N/A Primer for Sanger sequencing:, 50-GCAGAGCTAGCTGGGAAATG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, forward: 50-GCCTAGCCGAGGGAGAG CCG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 1: 50-TGTGACTTGGGAGCTC TGCAGC-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 2: 50-GCCGCCCCGACTGC ATCT-30 Integrated DNA Technologies N/A Primer sequences for qPCR, see Table S2 Integrated DNA Technologies N/A Recombinant DNA pAdDeltaF6 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV2/8 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-GFP Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-MCS Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A AGXT Human Tagged ORF Clone Origene CAT# RG212899 Software and algorithms ImageJ National Institutes of Health RRID:SCR_003070 https://imagej.nih.gov/ ij/download.html GraphPad Prism GraphPad Software Version 8.0 RRID:SCR_002798 https:// www.graphpad.com/scientific-software/ prism/ R statistics Hosted by Vienna, University of Economics and Business http://www.R-project.org/ RStudio RStudio Team (2020). https://www.rstudio.com/ RRID:SCR_000432 IBM SPSS software IBM Corporation Version 23.0; RRID:SCR_019096 https:// www.ibm.com/analytics/ spss-statistics-software FastQC Babraham Bioinformatics Version 0.11.8 RRID:SCR_014583 https:// www.bioinformatics.babraham.ac.uk/ projects/fastqc/ Trimmomatic Bolger et al., 2014 Version 0.35 RRID:SCR_011848 http:// www.usadellab.org/cms/? page=trimmomatic HISAT2 Kim et al., 2015 Version 2.1.0.13; RRID:SCR_015530 http:// daehwankimlab.github.io/hisat2/ download/ HTSeq Anders et al., 2015 Version 0.6.0; RRID:SCR_005514 https:// htseq.readthedocs.io/en/master/install. html (Continued on next page) Cell Reports 36, 109420, July 27, 2021 e3 Article ll OPEN ACCESS

Techniques: Over Expression, Injection, Western Blot, Clinical Proteomics, Gene Expression, MANN-WHITNEY

Figure 7. AAV-mediated overexpression of AGXT reduces atherosclerosis independent of circulating cholesterol AAV-AGXT or AAV-GFP was injected into male Apoe/ mice and the mice were fed a WD for 12 weeks (n = 8). (A) Plasma TC. (B) Atherosclerosis in the aortic tree. (C–E) H&E staining (D), ORO staining (D), and Mac- 2 immunohistochemistry (E) of aortic sinus. Scale bars, 200 mm. (F) Proposed model of dysregulated oxalate metabolism as a driver and therapeutic target in atherosclerosis. Unpaired t test for (A)–(E). Data are presented as mean ± SEM. All points and p values are shown.

Journal: Cell reports

Article Title: Dysregulated oxalate metabolism is a driver and therapeutic target in atherosclerosis.

doi: 10.1016/j.celrep.2021.109420

Figure Lengend Snippet: Figure 7. AAV-mediated overexpression of AGXT reduces atherosclerosis independent of circulating cholesterol AAV-AGXT or AAV-GFP was injected into male Apoe/ mice and the mice were fed a WD for 12 weeks (n = 8). (A) Plasma TC. (B) Atherosclerosis in the aortic tree. (C–E) H&E staining (D), ORO staining (D), and Mac- 2 immunohistochemistry (E) of aortic sinus. Scale bars, 200 mm. (F) Proposed model of dysregulated oxalate metabolism as a driver and therapeutic target in atherosclerosis. Unpaired t test for (A)–(E). Data are presented as mean ± SEM. All points and p values are shown.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer sequences for Agxt genotyping:, forward: 50-ACACCTCCACTGTCCTG TCC-30 Integrated DNA Technologies N/A Primer sequences for Agxt genotyping:, reverse: 50-GGTCAGATCTGCCTGCTA CC-30 Integrated DNA Technologies N/A Primer for Sanger sequencing:, 50-GCAGAGCTAGCTGGGAAATG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, forward: 50-GCCTAGCCGAGGGAGAG CCG-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 1: 50-TGTGACTTGGGAGCTC TGCAGC-30 Integrated DNA Technologies N/A Primer sequences for Apoe genotyping:, reverse 2: 50-GCCGCCCCGACTGC ATCT-30 Integrated DNA Technologies N/A Primer sequences for qPCR, see Table S2 Integrated DNA Technologies N/A Recombinant DNA pAdDeltaF6 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV2/8 Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-GFP Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A pAAV-TBG-MCS Jiandie Lin’s lab, University of Michigan; Guo et al., 2017 N/A AGXT Human Tagged ORF Clone Origene CAT# RG212899 Software and algorithms ImageJ National Institutes of Health RRID:SCR_003070 https://imagej.nih.gov/ ij/download.html GraphPad Prism GraphPad Software Version 8.0 RRID:SCR_002798 https:// www.graphpad.com/scientific-software/ prism/ R statistics Hosted by Vienna, University of Economics and Business http://www.R-project.org/ RStudio RStudio Team (2020). https://www.rstudio.com/ RRID:SCR_000432 IBM SPSS software IBM Corporation Version 23.0; RRID:SCR_019096 https:// www.ibm.com/analytics/ spss-statistics-software FastQC Babraham Bioinformatics Version 0.11.8 RRID:SCR_014583 https:// www.bioinformatics.babraham.ac.uk/ projects/fastqc/ Trimmomatic Bolger et al., 2014 Version 0.35 RRID:SCR_011848 http:// www.usadellab.org/cms/? page=trimmomatic HISAT2 Kim et al., 2015 Version 2.1.0.13; RRID:SCR_015530 http:// daehwankimlab.github.io/hisat2/ download/ HTSeq Anders et al., 2015 Version 0.6.0; RRID:SCR_005514 https:// htseq.readthedocs.io/en/master/install. html (Continued on next page) Cell Reports 36, 109420, July 27, 2021 e3 Article ll OPEN ACCESS

Techniques: Over Expression, Injection, Clinical Proteomics, Staining, Immunohistochemistry

Figure 1. MTDs Impair Cell Surface Expression of PD-1 by T Lymphocytes (A) Drug screen for inhibitors of cell surface PD-1 expression by human T cells gated from activated PBMCs. Microtubule-unrelated drugs (gray) and significant hits after Bonferroni correction for multiple comparisons versus untreated stimulated cells are shown as colored bars. CPT, camptothecin. n = 6, means ± SDs. (B) Representative contour plots of PD-1 and CD69 expression by resting and stimulated T lymphocytes treated or not treated with CI-980 (10 nM); gated from PBMC; representative of 6 experiments; percentages of cells in gate are shown. (C) Cell surface PD-1 expression by activated CD4+, CD8+, and TCR gd T lymphocytes (gated from activated PBMCs), treated or not treated with CI-980 (10 nM); representative of 6 experiments; percentages of cells in gate are shown. (D) CD3 and CD4, CD8, and TCR Vg9 expression by activated CD3+CD4+, CD3+CD8+, and CD3+TCR Vg9+ T cells, respectively, treated or not treated with CI-980 (10 nM); representative of 6 experiments. (E) CD3+ T cell differentiation, defined by the CD45RA and CCR7 markers, in treated (CI-980, 10 nM) or untreated conditions; representative of 6 experiments. (F–H) Quantification of the effect of CI-980 (10 nM) on CD3+ T cell differentiation (F), and on CD69 (G) and PD-1 (H) expression by the naive (CD45RA+CCR7+), central memory (CM) (CD45RACCR7+), effector memory (EM) (CD45RACCR7), and terminally differentiated effector memory (EMRA) (CD45RA+CCR7) T cells (n = 6, means ± SDs). Wilcoxon test; *p < 0.05, ***p < 0.001, ****p < 0.0001. (I) PD-1 inhibition level on activated T lymphocytes (gated from activated PBMCs) treated with MTDs including colchicin-binding site drugs (range of reds), vinca alkaloids (range of oranges), and taxane (green). CBT-A4, combretastatin-A4; PPTx, podophyllotoxin; b-Lumi, b-lumicolchicine (n = 6, means ± SDs).

Journal: Cell reports

Article Title: Microtubule-Driven Stress Granule Dynamics Regulate Inhibitory Immune Checkpoint Expression in T Cells.

doi: 10.1016/j.celrep.2018.12.014

Figure Lengend Snippet: Figure 1. MTDs Impair Cell Surface Expression of PD-1 by T Lymphocytes (A) Drug screen for inhibitors of cell surface PD-1 expression by human T cells gated from activated PBMCs. Microtubule-unrelated drugs (gray) and significant hits after Bonferroni correction for multiple comparisons versus untreated stimulated cells are shown as colored bars. CPT, camptothecin. n = 6, means ± SDs. (B) Representative contour plots of PD-1 and CD69 expression by resting and stimulated T lymphocytes treated or not treated with CI-980 (10 nM); gated from PBMC; representative of 6 experiments; percentages of cells in gate are shown. (C) Cell surface PD-1 expression by activated CD4+, CD8+, and TCR gd T lymphocytes (gated from activated PBMCs), treated or not treated with CI-980 (10 nM); representative of 6 experiments; percentages of cells in gate are shown. (D) CD3 and CD4, CD8, and TCR Vg9 expression by activated CD3+CD4+, CD3+CD8+, and CD3+TCR Vg9+ T cells, respectively, treated or not treated with CI-980 (10 nM); representative of 6 experiments. (E) CD3+ T cell differentiation, defined by the CD45RA and CCR7 markers, in treated (CI-980, 10 nM) or untreated conditions; representative of 6 experiments. (F–H) Quantification of the effect of CI-980 (10 nM) on CD3+ T cell differentiation (F), and on CD69 (G) and PD-1 (H) expression by the naive (CD45RA+CCR7+), central memory (CM) (CD45RACCR7+), effector memory (EM) (CD45RACCR7), and terminally differentiated effector memory (EMRA) (CD45RA+CCR7) T cells (n = 6, means ± SDs). Wilcoxon test; *p < 0.05, ***p < 0.001, ****p < 0.0001. (I) PD-1 inhibition level on activated T lymphocytes (gated from activated PBMCs) treated with MTDs including colchicin-binding site drugs (range of reds), vinca alkaloids (range of oranges), and taxane (green). CBT-A4, combretastatin-A4; PPTx, podophyllotoxin; b-Lumi, b-lumicolchicine (n = 6, means ± SDs).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data 30-UTR length (Grillo et al., 2010) http://utrdb.ba.itb.cnr.it Kinesin gene expression in immune cells NCBI GEO dataset repository GSE12195, GSE13738, GSE14879, GSE27291, GSE28490, GSE28491, GSE28726, GSE43769, GSE45535, GSE56314, GSE56464, GSE61697, GSE65010, GSE66384, GSE71566, GSE72642, GSE8059 Experimental Models: Cell Lines Human: HeLa cells ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides ON-TARGET plus Non-targeting Pool (siScramble) Dharmacon D-001810 ON-TARGET plus Human KIF1B siRNA Dharmacon L-009317 ON-TARGET plus Human KIF3A siRNA Dharmacon L-004964 ON-TARGET plus Human KIF5B siRNA Dharmacon L-008867 ON-TARGET plus Human KLC1 siRNA Dharmacon L-019482 ON-TARGET plus Human DYNC1H1 siRNA Dharmacon L-006828 See Table S4 for the list of Oligos N/A N/A Recombinant DNA PDCD1 cDNA coding vector Origene SC117011 PDCD1 cDNA coding vector (p1 - full 50UTR) This paper N/A CD3E cDNA coding vector (p13) This paper N/A Software and Algorithms Cytobank Stanford University, Stanford, California (Kotecha et al., 2010) https://www.cytobank.org/ ImageJ NIH https://imagej.nih.gov/ij/ Icy France-BioImaging, Institut Pasteur, France (de Chaumont et al., 2012) http://icy.bioimageanalysis.org/ Find Fasta max length This paper https://sites.google.com/site/fredsoftwares/ products/find-fasta-max-length Zen Blue Carl Zeiss Microscopy GmbH N/A Harmony 4.6 Perkin Elmer http://www.perkinelmer.com:80/product/ harmony-4-8-office-hh17000001 Vigibase World Health Organization’s (WHO) https://www.who-umc.org/vigibase/vigibase/ GraphPad Prism 7 GraphPad Software https://www.graphpad.com/scientific- software/prism/

Techniques: Expressing, Cell Differentiation, Inhibition, Binding Assay

Figure 2. PDCD1 mRNA Binds to Tubulin in Activated T Cells (A) Projection of confocal microscopy images of stimulated T lymphocytes treated or not treated with CI-980 (white lines, cell contour). Scale bar: 2 mm. Representative of 4 experiments. (B) Automated quantification of T cell staining for the specified marker in CI-980-treated cells (red, n = 73) and untreated control cells (purple, n = 53). Bars: group medians; Mann-Whitney test; ****p < 0.0001. (C) qRT-PCR quantification of PDCD1, CD69, and CD3E mRNAs immunoprecipitated from the lysates of activated T lymphocytes by anti-tubulin or isotype (Ig) control antibodies (n = 5, means ± SDs). t test; **p < 0.01. (D) RNA affinity chromatography of T cell lysates using biotinylated RNA fragments, as indicated, followed by western blot. FL, full length. Representative of 2 experiments. (E and F) Surface plasmon resonance sensorgrams of (E) T cell lysates on sensor chips coated with the specified PDCD1 mRNA fragment and (F) after the addition of antibodies to tubulin. Representative of 2 experiments. RU, resonance unit.

Journal: Cell reports

Article Title: Microtubule-Driven Stress Granule Dynamics Regulate Inhibitory Immune Checkpoint Expression in T Cells.

doi: 10.1016/j.celrep.2018.12.014

Figure Lengend Snippet: Figure 2. PDCD1 mRNA Binds to Tubulin in Activated T Cells (A) Projection of confocal microscopy images of stimulated T lymphocytes treated or not treated with CI-980 (white lines, cell contour). Scale bar: 2 mm. Representative of 4 experiments. (B) Automated quantification of T cell staining for the specified marker in CI-980-treated cells (red, n = 73) and untreated control cells (purple, n = 53). Bars: group medians; Mann-Whitney test; ****p < 0.0001. (C) qRT-PCR quantification of PDCD1, CD69, and CD3E mRNAs immunoprecipitated from the lysates of activated T lymphocytes by anti-tubulin or isotype (Ig) control antibodies (n = 5, means ± SDs). t test; **p < 0.01. (D) RNA affinity chromatography of T cell lysates using biotinylated RNA fragments, as indicated, followed by western blot. FL, full length. Representative of 2 experiments. (E and F) Surface plasmon resonance sensorgrams of (E) T cell lysates on sensor chips coated with the specified PDCD1 mRNA fragment and (F) after the addition of antibodies to tubulin. Representative of 2 experiments. RU, resonance unit.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data 30-UTR length (Grillo et al., 2010) http://utrdb.ba.itb.cnr.it Kinesin gene expression in immune cells NCBI GEO dataset repository GSE12195, GSE13738, GSE14879, GSE27291, GSE28490, GSE28491, GSE28726, GSE43769, GSE45535, GSE56314, GSE56464, GSE61697, GSE65010, GSE66384, GSE71566, GSE72642, GSE8059 Experimental Models: Cell Lines Human: HeLa cells ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides ON-TARGET plus Non-targeting Pool (siScramble) Dharmacon D-001810 ON-TARGET plus Human KIF1B siRNA Dharmacon L-009317 ON-TARGET plus Human KIF3A siRNA Dharmacon L-004964 ON-TARGET plus Human KIF5B siRNA Dharmacon L-008867 ON-TARGET plus Human KLC1 siRNA Dharmacon L-019482 ON-TARGET plus Human DYNC1H1 siRNA Dharmacon L-006828 See Table S4 for the list of Oligos N/A N/A Recombinant DNA PDCD1 cDNA coding vector Origene SC117011 PDCD1 cDNA coding vector (p1 - full 50UTR) This paper N/A CD3E cDNA coding vector (p13) This paper N/A Software and Algorithms Cytobank Stanford University, Stanford, California (Kotecha et al., 2010) https://www.cytobank.org/ ImageJ NIH https://imagej.nih.gov/ij/ Icy France-BioImaging, Institut Pasteur, France (de Chaumont et al., 2012) http://icy.bioimageanalysis.org/ Find Fasta max length This paper https://sites.google.com/site/fredsoftwares/ products/find-fasta-max-length Zen Blue Carl Zeiss Microscopy GmbH N/A Harmony 4.6 Perkin Elmer http://www.perkinelmer.com:80/product/ harmony-4-8-office-hh17000001 Vigibase World Health Organization’s (WHO) https://www.who-umc.org/vigibase/vigibase/ GraphPad Prism 7 GraphPad Software https://www.graphpad.com/scientific- software/prism/

Techniques: Confocal Microscopy, Staining, Marker, Control, MANN-WHITNEY, Quantitative RT-PCR, Immunoprecipitation, Chromatography, Western Blot, SPR Assay

Figure 3. PDCD1 30 UTR and ORF Are Important Regulatory Elements of PDCD1 mRNA Regulation (A) Schematic of the different constructs used for the transfection experiments in HeLa cells. (B) Representative western blots of PD-1 in lysates from HeLa cells transfected by the specified construct and treated or not treated with CI-980 (10 nM). Representative of 5 experiments. (C and D) PD-1 protein (C) and PDCD1 mRNA (D) levels in HeLa cells transfected with the specified construct and treated or not treated with CI-980 (10 nM), relative to the untreated p1 construct (n = 5, means ± SDs). t test; *p < 0.05, **p < 0.01, ***p < 0.001. (E) Representative western blots of CD3ε in the lysates from HeLa cells transfected with the p13 construct and treated or not treated with CI-980 (10 nM). Representative of 5 experiments. (F and G) CD3ε protein (F) and CD3E mRNA (G) levels in HeLa cells transfected with p13, and treated or not treated with CI-980 (10 nM), relative to the untreated construct (n = 5, means ± SDs). (H and I) PD-1 and CD3ε protein (H) and PDCD1 and CD3E mRNA (I) levels in HeLa cells transfected with the specified construct, treated or not treated with CI-980 (10 nM), relative to the untreated and native construct (p1 or p13, respectively); n = 3, means ± SDs; t test; *p < 0.05.

Journal: Cell reports

Article Title: Microtubule-Driven Stress Granule Dynamics Regulate Inhibitory Immune Checkpoint Expression in T Cells.

doi: 10.1016/j.celrep.2018.12.014

Figure Lengend Snippet: Figure 3. PDCD1 30 UTR and ORF Are Important Regulatory Elements of PDCD1 mRNA Regulation (A) Schematic of the different constructs used for the transfection experiments in HeLa cells. (B) Representative western blots of PD-1 in lysates from HeLa cells transfected by the specified construct and treated or not treated with CI-980 (10 nM). Representative of 5 experiments. (C and D) PD-1 protein (C) and PDCD1 mRNA (D) levels in HeLa cells transfected with the specified construct and treated or not treated with CI-980 (10 nM), relative to the untreated p1 construct (n = 5, means ± SDs). t test; *p < 0.05, **p < 0.01, ***p < 0.001. (E) Representative western blots of CD3ε in the lysates from HeLa cells transfected with the p13 construct and treated or not treated with CI-980 (10 nM). Representative of 5 experiments. (F and G) CD3ε protein (F) and CD3E mRNA (G) levels in HeLa cells transfected with p13, and treated or not treated with CI-980 (10 nM), relative to the untreated construct (n = 5, means ± SDs). (H and I) PD-1 and CD3ε protein (H) and PDCD1 and CD3E mRNA (I) levels in HeLa cells transfected with the specified construct, treated or not treated with CI-980 (10 nM), relative to the untreated and native construct (p1 or p13, respectively); n = 3, means ± SDs; t test; *p < 0.05.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data 30-UTR length (Grillo et al., 2010) http://utrdb.ba.itb.cnr.it Kinesin gene expression in immune cells NCBI GEO dataset repository GSE12195, GSE13738, GSE14879, GSE27291, GSE28490, GSE28491, GSE28726, GSE43769, GSE45535, GSE56314, GSE56464, GSE61697, GSE65010, GSE66384, GSE71566, GSE72642, GSE8059 Experimental Models: Cell Lines Human: HeLa cells ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides ON-TARGET plus Non-targeting Pool (siScramble) Dharmacon D-001810 ON-TARGET plus Human KIF1B siRNA Dharmacon L-009317 ON-TARGET plus Human KIF3A siRNA Dharmacon L-004964 ON-TARGET plus Human KIF5B siRNA Dharmacon L-008867 ON-TARGET plus Human KLC1 siRNA Dharmacon L-019482 ON-TARGET plus Human DYNC1H1 siRNA Dharmacon L-006828 See Table S4 for the list of Oligos N/A N/A Recombinant DNA PDCD1 cDNA coding vector Origene SC117011 PDCD1 cDNA coding vector (p1 - full 50UTR) This paper N/A CD3E cDNA coding vector (p13) This paper N/A Software and Algorithms Cytobank Stanford University, Stanford, California (Kotecha et al., 2010) https://www.cytobank.org/ ImageJ NIH https://imagej.nih.gov/ij/ Icy France-BioImaging, Institut Pasteur, France (de Chaumont et al., 2012) http://icy.bioimageanalysis.org/ Find Fasta max length This paper https://sites.google.com/site/fredsoftwares/ products/find-fasta-max-length Zen Blue Carl Zeiss Microscopy GmbH N/A Harmony 4.6 Perkin Elmer http://www.perkinelmer.com:80/product/ harmony-4-8-office-hh17000001 Vigibase World Health Organization’s (WHO) https://www.who-umc.org/vigibase/vigibase/ GraphPad Prism 7 GraphPad Software https://www.graphpad.com/scientific- software/prism/

Techniques: Construct, Transfection, Western Blot

Figure 4. Microtubule Motors Kinesin 1 Convey PDCD1 mRNA to Ribosomes (A) High-resolution microscopy of a-tubulin (green) and PDCD1 mRNA (orange) in HeLa cells transfected with full-length PDCD1. (B) Western blot (WB) of PD-1, CD3ε, and the indicated motor proteins in PDCD1- or CD3E-HeLa transfectants silenced by the specified small interfering RNA (siRNA) or by a scramble siRNA control (Scr). Representative of 3 experiments. (C) PD-1 and CD3ε protein levels in the specified siRNA-mediated knockdown experiment. Percentage of the level in transfectants silenced by Scr control (n = 3, means ± SDs). t test; *p < 0.05. (D) qRT-PCR quantification of PDCD1, CD69, and CD3E mRNAs after immunoprecipitation with an anti-KIF5B, anti-KLC1, anti-KIF1B, or isotype (Ig) control antibody from the lysates of activated T lymphocytes (n = 3, means ± SDs). (E) Polysomal profiling of HeLa cells treated or not treated with CI-980 (10 nM). Representative of 4 experiments. (F) PDCD1, CD3E, and GAPDH mRNA levels by qRT-PCR in non-polysomal (NP) and polysomal (P) fractions from HeLa cells transfected with the PDCD1 and CD3E plasmid reporters and treated or not treated with CI-980 (n = 4, means ± SDs). Wilcoxon test; **p < 0.01.

Journal: Cell reports

Article Title: Microtubule-Driven Stress Granule Dynamics Regulate Inhibitory Immune Checkpoint Expression in T Cells.

doi: 10.1016/j.celrep.2018.12.014

Figure Lengend Snippet: Figure 4. Microtubule Motors Kinesin 1 Convey PDCD1 mRNA to Ribosomes (A) High-resolution microscopy of a-tubulin (green) and PDCD1 mRNA (orange) in HeLa cells transfected with full-length PDCD1. (B) Western blot (WB) of PD-1, CD3ε, and the indicated motor proteins in PDCD1- or CD3E-HeLa transfectants silenced by the specified small interfering RNA (siRNA) or by a scramble siRNA control (Scr). Representative of 3 experiments. (C) PD-1 and CD3ε protein levels in the specified siRNA-mediated knockdown experiment. Percentage of the level in transfectants silenced by Scr control (n = 3, means ± SDs). t test; *p < 0.05. (D) qRT-PCR quantification of PDCD1, CD69, and CD3E mRNAs after immunoprecipitation with an anti-KIF5B, anti-KLC1, anti-KIF1B, or isotype (Ig) control antibody from the lysates of activated T lymphocytes (n = 3, means ± SDs). (E) Polysomal profiling of HeLa cells treated or not treated with CI-980 (10 nM). Representative of 4 experiments. (F) PDCD1, CD3E, and GAPDH mRNA levels by qRT-PCR in non-polysomal (NP) and polysomal (P) fractions from HeLa cells transfected with the PDCD1 and CD3E plasmid reporters and treated or not treated with CI-980 (n = 4, means ± SDs). Wilcoxon test; **p < 0.01.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data 30-UTR length (Grillo et al., 2010) http://utrdb.ba.itb.cnr.it Kinesin gene expression in immune cells NCBI GEO dataset repository GSE12195, GSE13738, GSE14879, GSE27291, GSE28490, GSE28491, GSE28726, GSE43769, GSE45535, GSE56314, GSE56464, GSE61697, GSE65010, GSE66384, GSE71566, GSE72642, GSE8059 Experimental Models: Cell Lines Human: HeLa cells ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides ON-TARGET plus Non-targeting Pool (siScramble) Dharmacon D-001810 ON-TARGET plus Human KIF1B siRNA Dharmacon L-009317 ON-TARGET plus Human KIF3A siRNA Dharmacon L-004964 ON-TARGET plus Human KIF5B siRNA Dharmacon L-008867 ON-TARGET plus Human KLC1 siRNA Dharmacon L-019482 ON-TARGET plus Human DYNC1H1 siRNA Dharmacon L-006828 See Table S4 for the list of Oligos N/A N/A Recombinant DNA PDCD1 cDNA coding vector Origene SC117011 PDCD1 cDNA coding vector (p1 - full 50UTR) This paper N/A CD3E cDNA coding vector (p13) This paper N/A Software and Algorithms Cytobank Stanford University, Stanford, California (Kotecha et al., 2010) https://www.cytobank.org/ ImageJ NIH https://imagej.nih.gov/ij/ Icy France-BioImaging, Institut Pasteur, France (de Chaumont et al., 2012) http://icy.bioimageanalysis.org/ Find Fasta max length This paper https://sites.google.com/site/fredsoftwares/ products/find-fasta-max-length Zen Blue Carl Zeiss Microscopy GmbH N/A Harmony 4.6 Perkin Elmer http://www.perkinelmer.com:80/product/ harmony-4-8-office-hh17000001 Vigibase World Health Organization’s (WHO) https://www.who-umc.org/vigibase/vigibase/ GraphPad Prism 7 GraphPad Software https://www.graphpad.com/scientific- software/prism/

Techniques: Microscopy, Transfection, Western Blot, Small Interfering RNA, Control, Knockdown, Quantitative RT-PCR, Immunoprecipitation, Plasmid Preparation

Figure 5. Activation-Induced SGs Regulate PD-1 Expression (A) qRT-PCR quantification of SG component mRNAs at different time points after T cell activation, in treated (CI-980, 10 nM) or untreated conditions (n = 3, means ± SDs). (B) qRT-PCR quantification of P-body component mRNAs at different time points after T cell activation, in treated (CI-980, 10 nM) or untreated conditions (n = 3, means ± SDs). (C) Protein quantification of SGs and P-body components at different time points after T cell activation, in treated (CI-980, 10 nM) or untreated conditions (n = 3, means ± SDs). A representative western blot is shown.

Journal: Cell reports

Article Title: Microtubule-Driven Stress Granule Dynamics Regulate Inhibitory Immune Checkpoint Expression in T Cells.

doi: 10.1016/j.celrep.2018.12.014

Figure Lengend Snippet: Figure 5. Activation-Induced SGs Regulate PD-1 Expression (A) qRT-PCR quantification of SG component mRNAs at different time points after T cell activation, in treated (CI-980, 10 nM) or untreated conditions (n = 3, means ± SDs). (B) qRT-PCR quantification of P-body component mRNAs at different time points after T cell activation, in treated (CI-980, 10 nM) or untreated conditions (n = 3, means ± SDs). (C) Protein quantification of SGs and P-body components at different time points after T cell activation, in treated (CI-980, 10 nM) or untreated conditions (n = 3, means ± SDs). A representative western blot is shown.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data 30-UTR length (Grillo et al., 2010) http://utrdb.ba.itb.cnr.it Kinesin gene expression in immune cells NCBI GEO dataset repository GSE12195, GSE13738, GSE14879, GSE27291, GSE28490, GSE28491, GSE28726, GSE43769, GSE45535, GSE56314, GSE56464, GSE61697, GSE65010, GSE66384, GSE71566, GSE72642, GSE8059 Experimental Models: Cell Lines Human: HeLa cells ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides ON-TARGET plus Non-targeting Pool (siScramble) Dharmacon D-001810 ON-TARGET plus Human KIF1B siRNA Dharmacon L-009317 ON-TARGET plus Human KIF3A siRNA Dharmacon L-004964 ON-TARGET plus Human KIF5B siRNA Dharmacon L-008867 ON-TARGET plus Human KLC1 siRNA Dharmacon L-019482 ON-TARGET plus Human DYNC1H1 siRNA Dharmacon L-006828 See Table S4 for the list of Oligos N/A N/A Recombinant DNA PDCD1 cDNA coding vector Origene SC117011 PDCD1 cDNA coding vector (p1 - full 50UTR) This paper N/A CD3E cDNA coding vector (p13) This paper N/A Software and Algorithms Cytobank Stanford University, Stanford, California (Kotecha et al., 2010) https://www.cytobank.org/ ImageJ NIH https://imagej.nih.gov/ij/ Icy France-BioImaging, Institut Pasteur, France (de Chaumont et al., 2012) http://icy.bioimageanalysis.org/ Find Fasta max length This paper https://sites.google.com/site/fredsoftwares/ products/find-fasta-max-length Zen Blue Carl Zeiss Microscopy GmbH N/A Harmony 4.6 Perkin Elmer http://www.perkinelmer.com:80/product/ harmony-4-8-office-hh17000001 Vigibase World Health Organization’s (WHO) https://www.who-umc.org/vigibase/vigibase/ GraphPad Prism 7 GraphPad Software https://www.graphpad.com/scientific- software/prism/

Techniques: Activation Assay, Expressing, Quantitative RT-PCR, Western Blot

Figure 7. MTDs Impair Inhibitory Checkpoint Expression by T Cells from Cancer Patients and Increase Autoimmunity Risk (A) Immunohistochemistry (IHC) staining for PD-1 expression by TILs (CD3) in biopsies from 2 Hodgkin lymphoma (HL) patients after chemotherapy including vinblastine. Magnification insert: 3400, bars: 500 mm. Results representative of 6 different HL patients. (B) Disproportionality analysis of immune-related adverse events (IrAE-ROR) for microtubule inhibitors (from VigiBase). Means and 95% confidence intervals are shown for each drug, including ICB (range of blues), MTDs of CBS type (range of reds), vinca alkaloid MTDs (range of oranges), taxane MTDs (range of greens), and control drugs for unrelated targets (range of purples). Total population size of N = 202,693 patients. (C) Association of in vitro IC50 for PD-1 expression and IrAE-RORs in 202,693 patients.

Journal: Cell reports

Article Title: Microtubule-Driven Stress Granule Dynamics Regulate Inhibitory Immune Checkpoint Expression in T Cells.

doi: 10.1016/j.celrep.2018.12.014

Figure Lengend Snippet: Figure 7. MTDs Impair Inhibitory Checkpoint Expression by T Cells from Cancer Patients and Increase Autoimmunity Risk (A) Immunohistochemistry (IHC) staining for PD-1 expression by TILs (CD3) in biopsies from 2 Hodgkin lymphoma (HL) patients after chemotherapy including vinblastine. Magnification insert: 3400, bars: 500 mm. Results representative of 6 different HL patients. (B) Disproportionality analysis of immune-related adverse events (IrAE-ROR) for microtubule inhibitors (from VigiBase). Means and 95% confidence intervals are shown for each drug, including ICB (range of blues), MTDs of CBS type (range of reds), vinca alkaloid MTDs (range of oranges), taxane MTDs (range of greens), and control drugs for unrelated targets (range of purples). Total population size of N = 202,693 patients. (C) Association of in vitro IC50 for PD-1 expression and IrAE-RORs in 202,693 patients.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data 30-UTR length (Grillo et al., 2010) http://utrdb.ba.itb.cnr.it Kinesin gene expression in immune cells NCBI GEO dataset repository GSE12195, GSE13738, GSE14879, GSE27291, GSE28490, GSE28491, GSE28726, GSE43769, GSE45535, GSE56314, GSE56464, GSE61697, GSE65010, GSE66384, GSE71566, GSE72642, GSE8059 Experimental Models: Cell Lines Human: HeLa cells ATCC CCL-2; RRID:CVCL_0030 Oligonucleotides ON-TARGET plus Non-targeting Pool (siScramble) Dharmacon D-001810 ON-TARGET plus Human KIF1B siRNA Dharmacon L-009317 ON-TARGET plus Human KIF3A siRNA Dharmacon L-004964 ON-TARGET plus Human KIF5B siRNA Dharmacon L-008867 ON-TARGET plus Human KLC1 siRNA Dharmacon L-019482 ON-TARGET plus Human DYNC1H1 siRNA Dharmacon L-006828 See Table S4 for the list of Oligos N/A N/A Recombinant DNA PDCD1 cDNA coding vector Origene SC117011 PDCD1 cDNA coding vector (p1 - full 50UTR) This paper N/A CD3E cDNA coding vector (p13) This paper N/A Software and Algorithms Cytobank Stanford University, Stanford, California (Kotecha et al., 2010) https://www.cytobank.org/ ImageJ NIH https://imagej.nih.gov/ij/ Icy France-BioImaging, Institut Pasteur, France (de Chaumont et al., 2012) http://icy.bioimageanalysis.org/ Find Fasta max length This paper https://sites.google.com/site/fredsoftwares/ products/find-fasta-max-length Zen Blue Carl Zeiss Microscopy GmbH N/A Harmony 4.6 Perkin Elmer http://www.perkinelmer.com:80/product/ harmony-4-8-office-hh17000001 Vigibase World Health Organization’s (WHO) https://www.who-umc.org/vigibase/vigibase/ GraphPad Prism 7 GraphPad Software https://www.graphpad.com/scientific- software/prism/

Techniques: Expressing, Immunohistochemistry, Control, In Vitro